EnhancerDB
  1. Home
  2. TFBS
  3. ID4[chr2:204629959-204629969]
Chromosome characteristics of ID4[chr2:204629959-204629969]
Back to top
Enhancers possibly regulated by ID4[chr2:204629959-204629969]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 204621645 204632759 enh19131
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Stomach Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Blood (T-cell) Epithelial (MCF-7)
SNP sites on ID4[chr2:204629959-204629969]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 204629960 rs528700481 T C 6302954
chr2 204629962 rs546815072 C T 6302955
chr2 204629967 rs144922376 GCTCCCAGATTTTGCTCTCCAGCTT G 6302956
chr2 204629967 rs71007550 GCTCCCAGATTTTGCTCTCCAGCTT G 6302957
Genes possibly regulated by ID4[chr2:204629959-204629969]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ID4[chr2:204629959-204629969]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results