EnhancerDB
  1. Home
  2. TFBS
  3. PRDM1[chr2:204881780-204881795]
Chromosome characteristics of PRDM1[chr2:204881780-204881795]
Back to top
Enhancers possibly regulated by PRDM1[chr2:204881780-204881795]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 204881745 204897975 enh19138
Brain (SK-N-MC) Blood (OCI-LY7) Muscle (A673) Placenta Peripheral Blood (MM.1S) Uterus Thymus Epithelial (MCF-7)
SNP sites on PRDM1[chr2:204881780-204881795]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 204881787 rs533916811 A C,T 6304334
chr2 204881787 rs541652308 A AGAGAGGGAGGAAGGAAGAGT 6304335
Genes possibly regulated by PRDM1[chr2:204881780-204881795]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PRDM1[chr2:204881780-204881795]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results