Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 180520740 180528855 enh45579

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 180528642 rs145863307 ATTTTTCACCTATGATATTGTTATAT A 7234103

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results