Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 181434130 181444165 enh36198
chr3 181440813 181441146 vista43360

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 181441007 rs370080271 CAGGACAGTTCCCTCAGTGCCACCACTGCGGGCA C 7235288
chr3 181441007 rs558825243 CAGGACAGTTCCCTCAGTGCCACCACTGCGGGCA C 7235289

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results