Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 217867505 217871655 enh109925

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 217871165 rs531509994 TCCCTTCTCAAGGCCCCAGCCCCAGC T 6357930

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results