Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 218010585 218018515 enh19225

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 218016358 rs570870294 T TTTGCTGGTCTTAACTATACAGTCACC 6359158
chr2 218016358 rs571518684 T C 6359159

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results