Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 218049205 218054295 enh99783

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 218053184 rs373235727 CTTTAAGTAAATGCATCTTTTGCTGTTTTAGCAA C 6359451

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results