Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 218606765 218610955 enh76561

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 218610408 rs187943606 A T 6364309
chr2 218610411 rs377736560 GCAGACTTATGAACTCCTCCC G 6364310

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results