Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 219942225 219948995 enh53573

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 219943973 rs367846494 CCTAGGCGTGCAAATCACCATG C 6370357

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results