Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 223330377 223335411 enh65403

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 223335338 rs138579673 A AGGATTAAGATATTGAACGT 6386033
chr2 223335338 rs377254321 A AGGATTAAGATATTGAACGT 6386034

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results