EnhancerDB
  1. Home
  2. TFBS
  3. RFX5[chr2:224884266-224884282]
Chromosome characteristics of RFX5[chr2:224884266-224884282]
Back to top
Enhancers possibly regulated by RFX5[chr2:224884266-224884282]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 224879732 224892955 enh48418
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Prostate (RWPE1) Blood (T-cell) Esophagus Bone (Osteoblast) Muscle (A673) Peripheral Blood (MM.1S) Lung (PC-9) Thymus Epithelial (MCF-7)
SNP sites on RFX5[chr2:224884266-224884282]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 224884267 rs138278326 GTTCACCATGGCACCCCAGCC G 6396801
chr2 224884269 rs13388692 T C 6396802
chr2 224884272 rs13426097 C G 6396803
Genes possibly regulated by RFX5[chr2:224884266-224884282]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RFX5[chr2:224884266-224884282]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results