Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 182426445 182450499 enh54522

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 182448602 rs146522881 ACATAATGGTAAGTAAAAGTG A 7240562
chr3 182448602 rs74271182 ACATAATGGTAAGTAAAAGTG A 7240563

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results