Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 228322694 228331795 enh19285

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 228323258 rs149202089 A ATTAAAATGAATTCTTAAAAAAGAATTC 6415780
chr2 228323258 rs57409479 A ATTAAAATGAATTCTTAAAAAAGAATTC 6415781

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results