Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 228505285 228528815 enh19287

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 228506992 rs140570899 C CTAAAA,CTAAAATAAAA 6416648
chr2 228506992 rs71412134 C CTAAAA 6416649
chr2 228506999 rs561461349 A AAAATAAAATAAAATAAAAG 6416650

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results