Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 230129825 230133975 enh99804

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 230131111 rs371711143 A AATTTTAACTTCAATAGGAG 6423390
chr2 230131111 rs374708474 A AATTTTAACTTCAATAGGAG 6423391

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr2 229715242 230136001 - PID1 ENSG00000153823.14 230136001 0.77 0.94 4890 3214


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results