EnhancerDB
  1. Home
  2. TFBS
  3. YY1[chr2:233187585-233187591]
Chromosome characteristics of YY1[chr2:233187585-233187591]
Back to top
Enhancers possibly regulated by YY1[chr2:233187585-233187591]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 233177325 233194055 enh19325
Bone Marrow (K562) Prostate (RWPE1) Blood (T-cell) Esophagus Astrocyte Placenta Thyroid Peripheral Blood (MM.1S) Embryonic Stem Cell Line (H1-hESC) Muscle (Myoblast) Breast Spleen Thymus Stomach
SNP sites on YY1[chr2:233187585-233187591]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 233187585 rs371942836 CGATGGCCCAGCTGGCCTCCTTAAGTCTGT C 6440588
chr2 233187585 rs538048020 CGATGGCCCAGCTGGCCTCCTTAAGTCTGT C 6440589
Genes possibly regulated by YY1[chr2:233187585-233187591]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by YY1[chr2:233187585-233187591]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results