| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 235839590 | 235843740 | enh70205 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 235840803 | rs60844187 | CAGCTCACCGCAACCTCCGCCTCCCAGATTCA | C | 6457821 | |
| chr2 | 235840803 | rs66494051 | CAGCTCACCGCAACCTCCGCCTCCCAGATTCA | C | 6457822 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|