Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 235839590 235843740 enh70205

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 235840803 rs60844187 CAGCTCACCGCAACCTCCGCCTCCCAGATTCA C 6457821
chr2 235840803 rs66494051 CAGCTCACCGCAACCTCCGCCTCCCAGATTCA C 6457822

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results