EnhancerDB
  1. Home
  2. TFBS
  3. BCL6B[chr2:238380867-238380884]
Chromosome characteristics of BCL6B[chr2:238380867-238380884]
Back to top
Enhancers possibly regulated by BCL6B[chr2:238380867-238380884]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 238378128 238387297 enh19395
Prostate (PC-3) Brain (SK-N-SH) Prostate (RWPE1) Blood (T-cell) Astrocyte Bone (Osteoblast) Placenta Muscle (Myoblast) Pancreas (Panc1) Uterus Thymus Epithelial (MCF-7)
SNP sites on BCL6B[chr2:238380867-238380884]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 238380871 rs551037225 GTTCCAGGAACAGGACTGTTTATGGGTGCA G 6479947
Genes possibly regulated by BCL6B[chr2:238380867-238380884]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by BCL6B[chr2:238380867-238380884]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results