Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 238378128 238387297 enh19395

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 238380871 rs551037225 GTTCCAGGAACAGGACTGTTTATGGGTGCA G 6479947

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results