Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 241335925 241340075 enh99824

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 241339404 rs572006839 G GCCCACCAGCCTGGACACAGGACTCAGGGA 6500754

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results