Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52915277 52915747 vista13480

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52915400 rs139863285 TGCCAGCTGCTTTAGGGAGG T 2639563
chr12 52915400 rs372152833 TGCCAGCTGCTTTAGGGAGG T 2639564

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 52908359 52914471 - KRT5 ENSG00000186081.7 52914471 0.99 0.99 919 12091


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results