Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 185866125 185874715 enh7743

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 185870194 rs556148114 T TTGTTCCCCTGTGGAACACGTTTGTGGCA 7258494
chr3 185870197 rs4407400 T C 7258495

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results