EnhancerDB
  1. Home
  2. TFBS
  3. RFX3[chr3:186736806-186736822]
Chromosome characteristics of RFX3[chr3:186736806-186736822]
Back to top
Enhancers possibly regulated by RFX3[chr3:186736806-186736822]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 186723085 186738090 enh7751
Liver (HepG2) Cervix (HeLa-S3) Large Intestine Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Placenta Thyroid Peripheral Blood (MM.1S) Blood (Karpas-422) Thymus Heart
SNP sites on RFX3[chr3:186736806-186736822]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 186736814 rs573539545 GTGGCAATCTCATGCCATTCAGAACCTCTGAT G 7264443
Genes possibly regulated by RFX3[chr3:186736806-186736822]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RFX3[chr3:186736806-186736822]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results