Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 34196049 34213655 enh10716

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 34198385 rs574801646 G A,T 10999566
chr9 34198388 rs11787558 C T 10999567
chr9 34198392 rs570011093 CTGCCTGGTTGGGCAGGCAGGT C 10999568

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results