Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 37307115 37314627 enh10750

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 37311455 rs367947052 CCCAGGGTGCAGAGGTGTGAT C 11013690
chr9 37311455 rs374938376 CCCAGGGTGCAGAGGTGTGAT C 11013691

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results