Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 38330685 38336518 enh73641

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 38334112 rs534586954 C CAATGGGAGGGAAAAACCTATATCTCAGTTCCTCT 11020702

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results