Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 109702325 109710548 enh42157

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 109705200 rs374064783 CATCTATCTATGCAGTTATGCT C 11202063

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results