Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 110619945 110640256 enh10884

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 110638769 rs533790033 T TTTTTGTTCACTAAACATTGACCAAGGGCC 11210132

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results