EnhancerDB
  1. Home
  2. TFBS
  3. NHLH1[chr9:110655535-110655547]
Chromosome characteristics of NHLH1[chr9:110655535-110655547]
Back to top
Enhancers possibly regulated by NHLH1[chr9:110655535-110655547]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 110655225 110659395 enh25872
Placenta Large Intestine Stomach
SNP sites on NHLH1[chr9:110655535-110655547]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 110655546 rs545297350 G GCATAGTGAACCAGCCTGGGAGTT 11210213
Genes possibly regulated by NHLH1[chr9:110655535-110655547]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NHLH1[chr9:110655535-110655547]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results