Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 110891262 110895455 enh73777

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 110892185 rs572978764 GAAAATTGAACAATGTATTATTCA G 11212293
chr9 110892190 rs370132778 T C 11212294

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results