Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 117942648 117946798 enh73784

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 117946303 rs140168297 GCACATGTTGTCAGGACTTCCTGAGGCTGTGT G 11254353
chr9 117946303 rs371953987 G A 11254354
chr9 117946303 rs377349964 GCACATGTTGTCAGGACTTCCTGAGGCTGTGT G 11254355

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results