Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 3354245 3362586 enh86507

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 3357353 rs537792843 C CTCTACAAAAAATACAAAAGTTAG 7357079

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results