EnhancerDB
  1. Home
  2. TFBS
  3. REST[chr4:3392077-3392096]
Chromosome characteristics of REST[chr4:3392077-3392096]
Back to top
Enhancers possibly regulated by REST[chr4:3392077-3392096]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 3385085 3395955 enh21316
Brain (SK-N-MC) Astrocyte Muscle (A673) Placenta Embryonic Stem Cell Line (H1-hESC) Uterus
SNP sites on REST[chr4:3392077-3392096]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 3392079 rs185412707 C T 7357353
chr4 3392079 rs540536551 C CGGCACCCGGCACAGCGGCT 7357354
Genes possibly regulated by REST[chr4:3392077-3392096]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by REST[chr4:3392077-3392096]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results