Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 4332908 4339250 enh45615

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 4333735 rs531700965 A AGGCCATGTGAGGACATGGCGAGAAGGT 7364226

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results