EnhancerDB
  1. Home
  2. TFBS
  3. SREBF2[chr4:5770535-5770545]
Chromosome characteristics of SREBF2[chr4:5770535-5770545]
Back to top
Enhancers possibly regulated by SREBF2[chr4:5770535-5770545]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 5769965 5778715 enh59301
Skin (Keratinocyte) Liver (HepG2) Prostate (RWPE1) Esophagus Muscle (A673)
SNP sites on SREBF2[chr4:5770535-5770545]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 5770542 rs112411830 CCACTGTACTCTAGCCTGGTGACAGAGCAA C 7372614
chr4 5770542 rs574471009 C T 7372615
chr4 5770543 rs6837283 C A 7372616
Genes possibly regulated by SREBF2[chr4:5770535-5770545]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SREBF2[chr4:5770535-5770545]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results