Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 8351685 8361755 enh36338

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 8356092 rs11933783 G A 7396887
chr4 8356095 rs568292901 TCACAGAGATTTCTGGCCACGGG T 7396888

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results