Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 8469185 8473835 enh100149

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 8470969 rs112074449 AGCCTCTAGCCATCTGGCGAGAGTG A 7397804
chr4 8470969 rs368641005 AGCCTCTAGCCATCTGGCGAGAGTG A 7397805

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results