Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 8592385 8598395 enh100150

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 8592754 rs34736554 AACAGGGTCAGACCCACTTTTATCCCCAGC A 7398907
chr4 8592754 rs35690242 AACAGGGTCAGACCCACTTTTATCCCCAGC A 7398908

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr4 8594387 8621488 + CPZ ENSG00000109625.14 8594387 0.95 0.98 1624 4528


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results