Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 83443765 83449595 enh21638

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 83449107 rs377378375 A AAGGAGAGAGTGAAAAGGGGTCAT 7649733
chr4 83449107 rs539454291 A AAGGAGAGAGTGAAAAGGGGTCAT 7649734

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results