Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 84269445 84273615 enh100208

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 84272890 rs564701174 CGGCTGGATTCTCACTTAACAAAAGGT C 7654181

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results