Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 108559825 108563975 enh100232

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 108560333 rs140785928 ACATTTTTTCCCTATGAAAAG A 7735762

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results