Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2843785 2847975 enh16504

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2847847 rs529029875 C CTTCTTTATTTTTCTTTTCT 4263988
chr16 2847850 rs374274994 CTTCTTTCTTTTTCTTTTCT C 4263989
chr16 2847857 rs577153875 C A 4263990

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results