Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2916034 2920992 enh3848

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2919159 rs533199951 TTAATTGTTTTGCTGTTTTACTACTA T 4264584
chr16 2919159 rs61285270 TTAATTGTTTTGCTGTTTTACTACTA T 4264585

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results