Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2950685 2956642 enh3849

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2955077 rs373182630 ACCTGTGGCTCCTCCAGCGG A 4265044
chr16 2955077 rs541822570 ACCTGTGGCTCCTCCAGCGG A 4265045

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results