Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 120373636 120379115 enh90259

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 120375830 rs28714318 C T 7777156
chr4 120375831 rs28495013 A C 7777157
chr4 120375840 rs564884474 TCACGGAAGGCGCGCTCTTGTGACGC T 7777158

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results