Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 120601297 120614335 enh88864

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 120604044 rs371070552 TTTGAATGCCAAAAATCTAGC T 7778100
chr4 120604044 rs376102205 TTTGAATGCCAAAAATCTAGC T 7778101
chr4 120604046 rs532745137 T A 7778102
chr4 120604047 rs546324712 G T 7778103

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results