Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 123605930 123613580 enh65884

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 123610515 rs145014922 AATCACTACTCAATATATTGATT A 7786706

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results