| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr16 | 5016965 | 5023692 | enh3864 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr16 | 5023403 | rs150801469 | GCTTCCGGAACAGTGTCAGCCTGGTTCTGCCAGGCCCA | G | 4280277 | |
| chr16 | 5023403 | rs370914454 | GCTTCCGGAACAGTGTCAGCCTGGTTCTGCCAGGCCCA | G | 4280278 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|