Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 5237005 5241155 enh69017

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 5240171 rs529266499 G GAACACCTGGACTCAAGTGATCCTC 4281184
chr16 5240176 rs368910581 C G 4281185

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results