Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 146195765 146203095 enh37155

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 146198924 rs554559890 A ACATTTCATCATTTCACATTTCATCATTTGGG 7860984

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results